The RNAcanvas app object encapsulates an entire RNAcanvas app instance.

Installation

With npm:

npm install @rnacanvas/app-object

Usage

Imports

// the RNAcanvas app object constructor
import { RNAcanvas } from '@rnacanvas/app-object';

Creating a new RNAcanvas app object

var app = new RNAcanvas();

Adding an RNAcanvas app instance to the document

It is important that an RNAcanvas app object be added to the document of a webpage since much of the underlying functionality related to SVG drawing only works for elements that have been added to the document.

// can also be added to any container node
app.appendTo(document.body);

// remove the RNAcanvas app object from its parent container node
app.remove();

The DOM node reference

The DOM node corresponding to an RNAcanvas app instance contains all of the elements that comprise an RNAcanvas app instance and can be accessed using the domNode property.

The DOM node reference can be used to set certain styles of an RNAcanvas app instance (e.g., width and height).

However, the internal contents and styling of the DOM node corresponding to an RNAcanvas app instance are not meant to be directly edited by outside code.

app.domNode;

app.domNode.style.width = '600px';
app.domNode.style.height = '400px';

The style property

For convenience, a style property is also provided that simply forwards to the style property of the DOM node corresponding to an RNAcanvas app instance.

app.style.width = '600px';
app.style.height = '750px';

The drawing of the app

The drawing of an RNAcanvas app instance represents an SVG document that is a two-dimensional nucleic acid structure drawing.

app.drawing;

Drawing structures

For convenience, structures expressed in dot-bracket notation can be drawn using the drawDotBracket method, which will append the specified structure to the drawing of the app.

Note that this method alone will not adjust the padding of the drawing or the user's view of the drawing after a structure has been drawn.

var seq = 'AGAGUAGCAUUCUGCUUUAGACUGUUAACUUUAUGAACCACGCGUGUCACGUGGGGAGAGUUAACAGCGCCC';
var dotBracket = '(((((((....)))))))...(((((((((((.....(((((.......)))))..))))))))))).....';

app.drawDotBracket(seq, dotBracket);

// ensure that the drawn structure fits inside the drawing
// (and include some extra space around the drawn structure)
app.drawing.setPadding(200);

app.drawingView.fitToContent();

The user's view of the drawing

The user's view of the drawing of the app is represented by the drawingView interface.

app.drawingView;

// the center point of the user's view of the drawing (in drawing coordinates)
app.drawingView.centerPoint = { x: 557, y: 1825 };
app.drawingView.centerPoint; // { x: 557, y: 1825 }

// adjusts the scaling of the drawing and scrollbar positions
// (to fit the content of the drawing all on screen)
app.drawingView.fitToContent();

The currently selected elements

The selectedSVGElements property represents the set of currently selected SVG elements in the drawing of the app.

app.selectedSVGElements.addAll([...app.drawing.secondaryBonds].slice(10, 20).map(sb => sb.domNode));

[...app.selectedSVGElements].forEach(ele => {
  ele.setAttribute('stroke', 'blue');
  ele.setAttribute('stroke-width', '3');
  ele.setAttribute('stroke-linecap', 'round');
});

app.selectedSVGElements.include([...app.drawing.secondaryBonds][10].domNode); // true

app.selectedSVGElements.removeAll([...app.drawing.secondaryBonds].slice(5, 12).map(sb => sb.domNode));
app.selectedSVGElements.include([...app.drawing.secondaryBonds][10].domNode); // false

app.selectedSVGElements.clear();
[...app.drawing.secondaryBonds].every(sb => !app.selectedSVGElements.include(sb.domNode)); // true

The currently selected SVG elements can also be listened to for when they change.

var numSelectedSVGElements = [...app.selectedSVGElements].length;

app.selectedSVGElements.addEventListener('change', () => numSelectedSVGElements = [...app.selectedSVGElements].length);

Similarly, the selectedBases property represents the currently selected set of bases in the drawing of the app.

let numSelectedBases = [...app.selectedBases].length;
app.selectedBases.addEventListener('change', () => numSelectedBases = [...app.selectedBases].length);

app.selectedBases.addAll([...app.drawing.bases].slice(25, 50));
numSelectedBases; // 25

app.selectedBases.include([...app.drawing.bases][25]); // true
app.selectedBases.include([...app.drawing.bases][24]); // false

The selectAll method can also be used to select all elements in the drawing of the app.

app.selectAll();

Opening forms

Forms can be opened using the openForm method.

// for controlling the layout of bases in the drawing of the app
app.openForm(app.basesLayoutForm);

// for exporting the drawing (e.g., as an SVG image)
app.openForm(app.exportForm);

In general, any element with absolute positioning (i.e., with a position CSS style of absolute) could potentially be opened as a custom form in an RNAcanvas app instance.

var customForm = document.createElement('div');
customForm.textContent = 'A custom form.';

customForm.style.position = 'absolute';
customForm.style.left = '50px';
customForm.style.top = '50px';

app.openForm(customForm);

Alternatively, a wrapping object can be opened as a form (i.e., input to the openForm method) so long as it fulfills the Form interface below.

interface Form {
  /**
   * Appends the DOM node corresponding to the form to the provided container node.
   */
  appendTo(container: Node): void;
}

Forms are positioned relative to the bounding box of the RNAcanvas app instance.

Forms are closed by simply removing them (i.e., by calling the remove method on their corresponding DOM nodes).

Forms can be made draggable by applying the DragTranslater class of the @rnacanvas/forms package to them.